Molecular Biology Reagents and Kits

Thermo Scientific™ Luminaris Color HiGreen qPCR Master Mix, High ROX

Thermo Scientific Luminaris Color HiGreen and Luminaris HiGreen qPCR Master Mixes are universal ready-to-use solutions optimized for qPCR and two-step RT-qPCR. 500RXN Luminaris Color HiGreen High ROX qPCRMastermix

Thermo Scientific™ 96-Well Semi-Skirted Plates, Flat Deck

96-well semi-skirted PCR plates with a flat deck for improved sealing in PCR and qPCR applications. X25 THERMO-FAST 96 PCR DET PLATE 25 plates

Thermo Scientific™ 0.2 mL Strip Tubes

Optimize PCR and qPCR with these 0.2 mL strip tubes, available as 8 tubes per strip in several colors or 12 tubes per strip. X120 STRIP 8X0,2ML DOMED REDpacks of 12

Fisherbrand™ Anodized Aluminum Blocks

Useful for a variety of applications in molecular biology, histology, clinical, environmental and industrial settings. Fisherbrand™ Anodized Aluminum Blocks are for use with Fisherbrand Digital Block Heaters.
BLOCK 24 TUBES EPP 1,5ML

Thermo Scientific™ Armadillo™ 384-Well PCR Plates

Optimize high throughput robotic PCR and qPCR applications with these uItra-rigid 384-well PCR plates with poylcarbonate frames and polypropylene wells. X50 PLATE PCR 384 CLR WELLS GRN

Fisherbrand™ 96-Well Low-Profile, Skirted PCR Plates

Fit most thermal cyclers X25 Fisherbrand PCR plate 96-wells, full skirt, PP, natural - FB-0800

Eppendorf™ 0.5 Model ThermoMixer™

ThermoMixer F0.5 w/thermoblock 24x0,5ml, GB plug

Thermo Scientific™ Armadillo™ 96-Well PCR Plate

Optimize robotic applications with these ultra-rigid 96-well PCR plates with U-bottom wells, available in various colors. X25 PCR hardshell plate Thermo Scientific 96 well25 plates

Thermo Scientific™ Thermo-Fast™ 96-Well Full-Skirted Plates

96-well full-skirted PCR automation compatible plate for use in PCR and qPCR applications. X25 THERMOFAST SK96X0,2ML MARKEDlettering, 25 plates

Thermo Scientific™ Luminaris Color HiGreen qPCR Master Mix

Thermo Scientific Luminaris Color HiGreen and Luminaris HiGreen qPCR Master Mixes are universal ready-to-use solutions optimized for qPCR and two-step RT-qPCR. 5000RXN Luminaris Color HiGreen qPCR MM (2x)

Fisherbrand™ 0.2mL PCR Tube Strips

Ideal for use in 0.2mL, 96-well V-bottom thermal cyclers X250 PCR 8-tubes 0.2ml strip w/domed cap, PP,natural, FB-0266

Thermo Scientific Pierce™ D-Luciferin

Get convenience and high performance at a low cost in firefly luciferase reporter assays with our D-Luciferin, formulated at greater than 99% purity as both monosodium and monopotassium salts. 1GR D-LUCIFERIN, MONOPOTASSIUM SALT

Thermo Scientific™ 96-Well Non-Skirted Plates

96-well non-skirted plates for use in PCR and qPCR applications. Available with black lettering for improved sample tracking during pipetting. X25 THERMOFAST 96X0,2ML BLACK(VE=25Stck.)

Water, Molecular Biology Grade, Fisher BioReagents

Chemical Name or Material: Water Name Note: 0.03μm filtered to ensure high purity CAS: 7732-18-5 Purity Grade: Molecular Biology Grade Purity Grade Notes: DNase-, RNase- and Protease-Free Physical Form: Liquid Molecular Formula: H2O Formula Weight: 18.02 20LT Water, Molecular Biology Grade (Sterile-Filtered)

Thermo Scientific™ pJET1.2 Sequencing Primers

Primers for sequencing of DNA fragments inserted into Eco32I site within the eco47IR gene of pJET1.2 and for colony screening by PCR. PJET1.2 REVERSE SEQUENCING PRIMER, 24-MER, 5'-D(AAGAACATCGATTTTCCATGGCAG)-3', 10┬Ám, 8.4nmol Store

Thermo Scientific™ Maxima SYBR Green/Fluorescein qPCR Master Mix (2X)

Ready-to-use solution optimized for qPCR and 2-step RT-qPCR. X10 qPCR, Maxima(R) SYBR green/Fluorescein qPCR

Thermo Scientific™ Maxima™ Probe 2X qPCR Master Mix with ROX Solution

Optimize qPCR with probe chemistry using standard cycling protocols with these ready-to-use qPCR master mixes. X10 qPCR, Maxima(R) probe qPCR master mix, ROX

Thermo Scientific™ 96-Well Non-Skirted Plates, Low Profile

Low profile 96-well plates for use in PCR and qPCR applications. X25 THERMOFAST LP 96X0,2ML REDProfile, red, 25 plates

Thermo Scientific™ Nuclease-free Water

X4 Molecular biology reagents, water, nuclease-fre

Thermo Scientific™ ABgene™ EasyStrip PCR Tubes

Each tube in the strip has an individually sealable cap to reduce the chance of sample contamination. PCR and QPCR setup and analysis are made much simpler with the unique design of these new tubes. EASYSTRIP SNAP TUBE NATURAL TUBE

Thermo Scientific™ 0.1 mL Individual UTW Tubes

Reduce incubation times during PCR with these ultra-thin wall individual PCR tubes with attached flat caps. PCR TUBE W/CLR CAP,WHITE 960/CS, VE=960 St.

Alfa Aesar™ Water, DEPC-Treated

1LT Water, DEPC-Treated

Eppendorf™ PCR Tubes

Ensure efficient heat transfer to the sample with these tubes, thanks to their thin, even wall thickness and smooth wall surface. Eppendorf™ PCR Tubes are easy to open, but provide tight sealing to prevent evaporation in PCR. X500 Tubes PCR thin-walled 0.5mL (pack of 500)

Thermo Scientific™ PCR Tubes and Plates

Efficiently perform applications with these PCR tubes and plates, molded from 100% virgin polypropylene. X25 MICRO TUBE THIN WALL PUREPAK 24 X 0.2 WELLS(pack of 25)

Eppendorf™ Cable

Cable Eppendorf for mastercycler ep 150cm

Thermo Scientific™ Microtiter Tubes and Racks

Seal microtiter tubes tightly for storage with these polyethylene plug strips for use with 1.2mL MCT Titertube Racks.

X1000 TUBE 1,2ML BULK PP NST

Thermo Scientific™ DEPC-treated Water

X5 Molecular biology reagents, DEPC-treated water

Eppendorf™ PCR Tube Strips, 0.1mL

Designed for single use PCR applications. Eppendorf™ PCR Tube Strips provide tight sealing to prevent evaporation in PCR, yet are easy to open. They ensure efficient heat transfer to the sample by virtue of their thin, even wall thickness and smooth wall surface. X120 PCR 8 TUBE STRIPS 0,1ML

Thermo Scientific™ ABgene™ Thermo-Fast™ 96-Well Semi-Skirted PCR Plates

Patented segmented design allows plate to be cut into 24- and 48-well sections X25 PCR plate Thermo-Fast 96 well semi-skirted (MP 52 PROMO)

Thermo Scientific™ 384-Well Full Skirted PCR Plates

Reduce well-to-well variability with 384-Well PCR Plate Full Skirted PCR Plates, thin walled for efficient heat transfer and compatible with most major thermal cyclers. X50 THERMO-FAST 384 PCR PLATEplates

  spinner