missing translation for 'onlineSavingsMsg'
Learn More

Thermo Scientific™ M13/pUC Sequencing Primer (-46), 22-mer

Product Code. 10384680 Shop All Thermo Scientific Products
Change view
Click to view available options
Quantity:
10 μM, 45 μL
Unit Size:
Each
1 product options available for selection
Product selection table with 1 available options. Use arrow keys to navigate and Enter or Space to select.
Product Code. Quantity unitSize
10384680 10 μM, 45 μL Each
Use arrow keys to navigate between rows. Press Enter or Space to select a product option. 1 options available.
1 options
This item is not returnable. View return policy
To receive the discount customers must purchase three of the same product at list price in a single order to receive 33% discount. There is no limit to the multiples of 3 that customers can buy. Use promo code ”27968” to get your promotional price
Product Code. 10384680 Supplier Thermo Scientific™ Supplier No. SO114

Please to purchase this item. Need a web account? Register with us today!

This item is not returnable. View return policy
To receive the discount customers must purchase three of the same product at list price in a single order to receive 33% discount. There is no limit to the multiples of 3 that customers can buy. Use promo code ”27968” to get your promotional price

Thermo Scientific M13/pUC Sequencing Primer (-46), 22-mer is a synthetic single-stranded 22-mer oligonucleotide with free 5'- and 3'-hydroxyl ends.

Thermo Scientific M13/pUC Sequencing Primer (-46), 22-mer is a synthetic single-stranded 22-mer oligonucleotide with free 5'- and 3'-hydroxyl ends. This M13/pUC primer anneals to the region in the 5'-terminus of the lacZ gene. All primers are supplied as 10 μM aqueous solutions.

Applications
• Sequencing of DNA fragments inserted into the MCS within the lacZ gene of various cloning vectors, such as pUC19 (Cat. No. SM0221), pTZ19R, pTZ57R, M13mp18, and pBluescript II
• Colony screening by PCR

Primer Sequence: 5'-d(GCCAGGGTTTTCCCAGTCACGA)-3'

TRUSTED_SUSTAINABILITY

Specifications

Product Type Sequencing Primer
Content And Storage M13/pUC Sequencing Primer (-46), 22-mer, 10 μM (45 μL)

Store at –20°C.
Shipping Condition Dry Ice
Concentration 10 μM
Primer M13
Quantity 10 μM, 45 μL
Vector pUC19, pTZ19R, pTZ57R, M13mp18, pBluescript II
For Use With (Application) Sequencing
Form Liquid

For Research Use Only. Not for use in diagnostic procedures.

Product Title
Select an issue

By clicking Submit, you acknowledge that you may be contacted by Fisher Scientific in regards to the feedback you have provided in this form. We will not share your information for any other purposes. All contact information provided shall also be maintained in accordance with our Privacy Policy.