missing translation for 'onlineSavingsMsg'
Learn More

Invitrogen™ BLOCK-iT™ Pol II miR RNAi Expression Vector Kit with EmGFP

Product Code. 10206432
Change view
Click to view available options
Quantity:
20 Reactions
Unit Size:
Each
1 product options available for selection
Product selection table with 1 available options. Use arrow keys to navigate and Enter or Space to select.
Product Code. Quantity Unit Size
10206432 20 Reactions Each
Use arrow keys to navigate between rows. Press Enter or Space to select a product option. 1 options available.
1 options
This item is not returnable. View return policy
Product Code. 10206432 Supplier Invitrogen™ Supplier No. K493600
Curiosity Goes Beyond
Use promo code 27966
View all promotions
 Restricted Item
Estimated Shipment: 10-09-2026
Add to basket
Add to basket
This item is not returnable. View return policy

Includes

The BLOCK-iT™Pol II miR RNAi Expression Vector Kit contains two boxes. The cloning box contains linearized pcDNA™6.2-GW/miR, 10X annealing buffer, T4 DNA Ligase, 5X DNA Ligation buffer, lacZ control oligo, lacZ control plasmid, negative control plasmid, DNase/RNase-free water, and forward and reverse sequencing primers.

Combines the advantages of traditional RNAi vectors (stable expression and the ability to use viral delivery) with capabilities for tissue-specific expression and multiple target knockdown from the same transcript

The pcDNA™6.2-GW/EmGFP-miR vector included in the BLOCK-iT Pol II miR RNAi Expression Vector Kit with EmGFP is designed to express artificial miRNAs which are engineered to have 100% homology to your target sequence and will result in target cleavage. This vector includes flanking and loop sequences from an endogenous miRNA which directs the excision of the engineered miRNA from a longer Pol II transcript (pre-miRNA). Using Invitrogen's award-winning BLOCK-iT RNAi Designer, over 70% of constructs produce more than 70% knockdown. Pol II expression of engineered miRNAs enables:

  • Strong expression from the CMV immediate early promoter, with the option to use tissue-specific or other regulated promoters via MultiSite Gateway™ recombination
  • Co-cistronic expression of an Emerald GFP (EmGFP) reporter in the pcDNA6.2-GW/EmGFP-miR vector, resulting in very strong correlation of EmGFP expression with the knockdown activity of your miRNA
  • Compatibility with many of Invitrogen's Gateway destination (DEST) vectors for gene expression; including Lentiviral vectors for stable transduction of dividing, non-dividing and primary cell types, the Flp-In™ system for single-site chromosomal integration, and alternative reporter fusion constructs
  • Expression of more than one engineered miRNA on the same transcript, allowing the knockdown of multiple genes simultaneously and the generation of synthetic phenotypes
How it Works
For high levels of expression of your miR RNAi sequence, the pcDNA6.2-GW/miR vector includes the CMV promoter. Simply input a RefSeq accession number or a nucleotide sequence into the free online BLOCK-iT RNAi Designer and the software will design optimized miRNAs that have 100% homology to the target of interest. Clone the miRNA into the vector using a fast ligation protocol and transfect for immediate miRNA expression. Expressed miRNA is processed by the endogenous cellular machinery in the nucleus (including Drosha) and then transported into the cytoplasm where it is further processed by Dicer. The fully processed miRNA is then incorporated into RISC where it functions like an siRNA and results in cleavage of the mRNA target.
For a variety of expression options, the miRNA cassette, which contains EmGFP, miR flanking regions, and an miRNA homologous to the target of interest, can be readily moved into a variety of DEST vectors. This occurs through Gateway recombination reactions in which the miRNA cassette is transferred into a pDONR™ vector (BP reaction) and then into a DEST vector (LR reaction) of choice .

Cloning, Gateway Cloning, RNAi, RNAi, Epigenetics and Non-Coding RNA Research, Vector-Based RNAi

TRUSTED_SUSTAINABILITY

Specifications

Product Type RNAi Expression Vector Kit
Gene GFP (EmGFP)
Content And Storage The BLOCK-iT™Pol II miR RNAi Expression Vector Kit contains two boxes. The cloning box contains linearized pcDNA™6.2-GW/EmGFP-miR, 10X annealing buffer, T4 DNA Ligase, 5X DNA Ligation buffer, lacZ control oligo, lacZ control plasmid, negative control plasmid, DNase/RNase-free water, and forward and reverse sequencing primers. Store the vectors, buffers, control oligo and plasmids, water, and sequencing primers at -20°C. The One Shot™ box contains transformation reagents including twenty-one 50-μl aliquots of One Shot™ TOP10 Chemically Competent E. coli, S.O.C. medium, and a pUC19 supercoiled control plasmid. Store these transformation reagents -80°C. All reagents are guaranteed stable for 6 months when properly stored.
Cloning Method Gateway™
Constitutive or Inducible System Constitutive
Delivery Type Transfection
RNAi Type miRNA
Selection Agent (Eukaryotic) Blasticidin
Vector BLOCK-iT RNAi Vectors
Promoter CMV
Format Kit
Product Line BLOCK-iT, Gateway
Quantity 20 Reactions
Show More Show Less
Can I chain miRNA to enhance knockdown or to knock down multiple targets? Do your vectors allow this?

miRNAs are sometimes expressed in clusters in long primary transcripts driven by RNA Pol II (Lee et al., 2004). Our vectors support chaining of miRNAs to express them in one primary transcript, thus ensuring co-cistronic expression of multiple miRNAs. In the final construct, the original pattern of restriction sites is regenerated, making the construct amenable to multiples rounds of chaining. The figure below shows the principle of chaining two miRNAs, derived from two different miRNA vectors, into one miRNA expression vector. Note: Chaining together miRNAs targeting different genes usually results in slightly reduced knockdown of each gene. Chaining different miRNAs targeting the same gene or repeating one miRNA can enhance knockdown. Due to increased processing, EmGFP expression is attenuated by miRNA chaining. See page 33 of the manual for directions on how to chain pre-miRNAs.

What are the excitation and emission wavelengths of EMGFP? How can I detect them?

The EmGFP from the pcDNA6.2-GW/EmGFP-miR expression vector has the following excitation and emission wavelengths, as published in the literature (Tsien, 1998): 487 nm and 509 nm, respectively. Detection can be performed using a standard FITC filter set. We recommend Omega XF100.

What is the best way to determine what cells are expressing my miRNA of interest?

We would recommend use of our pcDNA6.2GW/EmGFP-miR vector, where EmGFP is expressed co-cistronically with your miRNA of interest. You should see 100% correlation of EmGFP expression with the knockdown activity of your miRNA.

Can I express native precursor microRNA (pre-miRNA or pri-miRNA) using your miR RNAi expression system?

The vectors are designed and optimized for expressing modified miR155 structure, and finally make siRNA for gene targeting using RNAi pathways. Additional optimization might be necessary to express native miRNA. Alternatively, the sequences of native miRNA can be cloned into a standard protein expression vector and inspect for miRNA production. Please see our two suggestions for miRNA overexpression:

1. Use PCR on gDNA to amplify the endogenous pre-miRNA hairpin as well as ~50-80 bp of flanking sequences on each side, then TOPO clone into an expression vector such as one of our pcDNA vectors. This will produce a transcript which contains the pre-miRNA in the context of its natural flanking sequences. This will probably be the best mimic of the endogenous miRNA, because the flanking sequences and precursor have the information needed to correctly process out the mature miRNA. The disadvantage of this technique is that it is somewhat laborious and wouldn't be as amenable to looking at many miRNAs (each one requiring identification of the genomic locus, primer design, and successful PCR).
2. Use the mature miRNA sequence (or the first 21 nucleotides of it) as the “antisense” sequence in Invitrogen's BLOCK-iT Pol II miR RNAi vector system. This technique has been successfully published (see Lee et al., PNAS 2006;103;15669-15674) and is quick and simple for design and cloning.
Using this method, many miRNA vectors could be built the same way. We also have a fairly good understanding that the major product of the miR RNAi vectors has the expected 5' end for the mature miRNA. However, we also know that the 3' end is variable and includes a number of slightly smaller and longer species that can include nucleotides from the loop (GUU…). The 3' end is probably least critical to miRNA function, but there may be some miR:target interactions for which it is important, and we just don't know how closely these mimic endogenous miRNAs.

What are the advantages of using miR RNAi expression vector kits?

These vectors can be used for stable expression and the ability to use viral delivery. These miR RNAi vectors include flanking and loop sequences from an endogenous miRNA which directs the excision of the engineered miRNA from a longer Pol II transcript (pri-miRNA). When present in the nucleus, these vectors efficiently use the endogenous cellular machinery to process knockdown sequences that are specifically designed to have 100% homology to your target of interest and will result in target cleavage. In addition, the loop sequence has a unique restriction site, so that it can be linearized for more efficient sequencing, sometimes a challenge with standard shRNA hairpins. The kits offer over 70% knockdown success, easy expression tracking (with co-cistronic expression of Green Fluorescent Protein), multiple target knockdown, and constitutive or inducible expression.

How large of a PCR product can I recombine with a pDONR vector via BP cloning? Does the same apply for TOPO-adapted Entry vectors?

There is no theoretical limit to insert size for a BP reaction with a pDONR vector. Maximum size tested in-house is 12 kb. TOPO vectors are more sensitive to insert size and 3-5 kb is the upper limit for decent cloning efficiency.

How should I clean up my attB-PCR product?

After generating your attB-PCR product, we recommend purifying it to remove PCR buffer, unincorporated dNTPs, attB primers, and any attB primer-dimers. Primers and primer-dimers can recombine efficiently with the Donor vector in the BP reaction and may increase background after transformation into E. coli, whereas leftover PCR buffer may inhibit the BP reaction. Standard PCR product purification protocols using phenol/chloroform extraction followed by ammonium acetate and ethanol or isopropanol precipitation are not recommended for purification of the attB-PCR product as these protocols generally have exclusion limits of less than 100 bp and do not efficiently remove large primer-dimer products. We recommend a PEG purification protocol (see page 17 of the Gateway Technology with Clonase II manual). If you use the above protocol and your attB-PCR product is still not suitably purified, you may further gel-purify the product. We recommend using the PureLink Quick Gel Extraction kit.

I'm trying to propagate my Gateway destination vector and am not seeing any colonies. What should I do?

Check the genotype of the cell strain you are using. Our Gateway destination vectors typically contain a ccdB cassette, which, if uninterrupted, will inhibit E. coli growth. Therefore, un-cloned vectors should be propagated in a ccdB survival cell strain, such as our ccdB Survival 2 T1R competent cells.

What is the difference between LR Clonase II and LR Clonase II Plus?

LR Clonase II Plus contains an optimized formulation of recombination enzymes for use in MultiSite Gateway LR reactions. LR Clonase and LR Clonase II enzyme mixes are not recommended for MultiSite Gateway LR recombination reactions, but LR Clonase II Plus is compatible with both multi-site and single-site LR recombination reactions.

What are the benefits of the BLOCK-iT miR RNAi expression system over similar systems?

The BLOCK-iT miR RNAi expression system allows you to take advantage of promoter flexibility by choosing from a variety of Pol II promoters like CMV, Ubc, tissue specific, or inducible promoters. The miRNA vectors also allow you to clone multiple sequences in the same vector, thereby enabling you to target more than one gene or more than one location in a gene using a single plasmid. An additional advantage offered by some of the miRNA expression vectors is that transfection efficiency can be monitored with the EmGFP fusion partner.

How can I tell which sequence will be a potent miRNA sequence?

We offer a free online RNAi design program to help you design an effective miRNA sequence. The RNAi designer can be found at https://rnaidesigner.invitrogen.com/rnaiexpress/, or search "RNAi Designer" from the homepage of thermofisher.com.

Can I target multiple genes or multiple locations within a gene using the BLOCK-iT miR RNAi expression system?

Yes. The miRNA cloning vectors are designed such that you can easily chain together multiple miRNAs to express them in one transcript. This can be used to increase transcription levels of the same miRNA sequence, or to combine multiple different sequences in one co-cistronic expression cassette.

Are the BLOCK-iT miR RNAi Expression Kits compatible with adenoviral expression systems?

Yes. The miR miRNA vectors are Gateway cloning compatible, and you could use Gateway cloning to transfer the miR miRNA expression cassette to any of our Gateway-adapted viral expression vectors.

How do the BLOCK-iT miR RNAi Kits work? Do they cleave the specific mRNA target or just suppress translation? Can this system be used for analyzing endogenous miRNAs?

The miRNA vectors use endogenous miRNA processing machinery to allow targeted RNAi knockdown of specific genes, but they are not tested for use in the analysis of endogenous miRNA. Endogenous miRNAs are typically not 100% homologous to their targets and thus invoke translational suppression. Our products are designed with 100% homology to the target gene and generally result in target mRNA cleavage.

How do the BLOCK-iT shRNA products compare to the BLOCK-iT miR RNAi system?

Both systems are used for gene targeting or gene knockdown but each has distinctive features. The shRNA expression vectors like pENTR/U6 or pENTR/H1-TO use Pol III promoters, whereas the miRNA expression vectors are flexible to use more common and more processive Pol II promoters like CMV, EF1 or other mammalian expression promoters. You can only clone a single shRNA sequence into an shRNA vector to target a single gene, whereas multiple miRNA sequences can be cloned together into an miRNA vector to target one or more genes, or multiple locations in a gene. An additional feature of the miRNA expression vectors is that, due to use of Pol II promoters, the miRNA can be expressed directly in fusion with a reporter gene like EmGFP to monitor transfection and transcription.

What are the different promoter choices available with the BLOCK-iT miR RNAi expression system?

All the BLOCK-iT miR RNAi expression vectors are Gateway-adapted and contain the CMV promoter. If more specialized expression is required with a different promoter, the miRNA vectors allow for easy recombination with any other suitable destination vector that Thermo Fisher Scientific offers. A wide variety of Gateway Destination vectors that contain promoters such as EF-1apha or Ubc are available, and all be used for miRNA expression. MultiSite Gateway Technology vectors are also available which will enable you to use a tissue-specific promoter or a promoter of your choice to express miRNA.

What is the purpose of the Proteinase K step following a Gateway LR Recombination reaction, and is it critical to the results?

When the LR reaction is complete, the reaction is stopped with Proteinase K and transformed into E. coli resulting in an expression clone containing a gene of interest. A typical LR reaction followed by Proteinase K treatment yields about 35,000 to 150,000 colonies per 20ul reaction. Without the Proteinase K treatment, up to a 10 fold reduction in the number of colonies can be observed. Despite this reduction, there are often still enough colonies containing the gene of interest to proceed with your experiment, so the Proteinase K step can be left out after the LR reaction is complete if necessary.

Can I go directly from a pENTR/D-TOPO reaction into an LR Clonase Reaction without first purifying the DNA?

In most cases, there will not be enough pENTR vector DNA present to go directly from TOPO cloning into an LR reaction. You need between 100-300 ng of pENTR vector for an efficient LR reaction, and miniprep of a colony from the TOPO transformation is necessary to obtain that much DNA. However, if you want to try it, here are some recommendations for attempting to go straight into LR reactions from the TOPO reaction using pENTR/D, or SD TOPO, or pCR8/GW/TOPO vectors:

1. Heat inactivate the topoisomerase after the TOPO cloning reaction by incubating the reaction at 85 degrees C for 15 minutes.
2. Use the entire reaction (6 µL) in the LR clonase reaction. No purification steps are necessary.
3. Divide the completed LR reaction into 4 tubes and carry out transformations with each tube. You cannot transform entire 20 µL reaction in one transformation, and we have not tried ethanol precipitation and then a single transformation.

When attempting this protocol, we observed very low efficiencies (~10 colonies/plate). So just be aware that while technically possible, going directly into an LR reaction from a TOPO reaction is very inefficient and will result in a very low colony number, if any at all.

Can N-terminal or C-terminal tags be attached to a Gateway Entry clone?

To have an N-terminal tag, the gene of interest must be in the correct reading frame when using non-TOPO adapted Gateway entry vectors. All TOPO adapted Gateway Entry vectors will automatically put the insert into the correct reading frame, and to add the N-terminal tag you simply recombine with a destination vector that has N-terminal tag.

To attach a C-terminal tag to your gene of interest, the insert must lack its stop codon, and be in the correct reading frame for compatibility with our C-terminal tagged destination vectors. Again, TOPO adapted Gateway Entry vectors will automatically put the insert into the correct reading frame. If you do not want the C-terminal tag to be expressed, simply include a stop codon at the end of the insert that is in frame with the initial ATG.

Generally, you need to choose a destination vector before you design and clone your insert into the Entry vector. This will determine whether you need to include an initiating ATG or stop codon with your insert.

Can an attB-PCR product be cloned directly into an expression (Gateway Destination) vector?

No, not directly. The attB-PCR product must first be cloned, via a BP Clonase reaction, into a pDONR vector which creates an "Entry Clone" with attL sites. This clone can then be recombined, via an LR Clonase reaction, with a Destination vector containing attR sites. However, It is possible to perform both of these reactions in one step using the "One-Tube Protocol" described in the manual entitled "Gateway Technology with Clonase II".

Can Gateway technology be used to express two proteins from the same vector?

Yes, this can be done using the Multisite Gateway Technology. MultiSite Gateway Pro Technology enables you to efficiently and conveniently assemble multiple DNA fragments - including genes of interest, promoters, and IRES sequences - in the desired order and orientation into a Gateway Expression vector. Using specifically designed att sites for recombinational cloning, you can clone two, three, or four DNA fragments into any Gateway Destination vector containing attR1 and attR2 sites. The resulting expression clone is ready for downstream expression and analysis applications.

What is the efficiency of recombination in the Gateway system?

For the BP reaction, approximately 5-10% of the starting material is converted into product. For the LR reaction, approximately 30% of the starting material is converted into product.

Are there common restriction sites that can be used to excise a gene out of a Gateway plasmid?

The core region of the att sites contains the recognition sequence for the restriction enzyme BsrGI. Provided there are no BsrGI sites in the insert, this enzyme can be used to excise the full gene from most Gateway plasmids. The BsrGI recognition site is 5'-TGTACA and is found in both att sites flanking the insertion site.

If a different restriction site is desired, the appropriate sequence should be incorporated into your insert by PCR.

Do I have to synthesize new attB primers (29 base attB primer + my specific sequence primer) each time I want to make an attB PCR product, or do you have truncated attB primers that work together with adapter attB primers to get a complete attB sequence?

We do have an alternative method called the "attB Adapter PCR" Protocol in which you make your gene specific primer with only 12 additional attB bases and use attB universal adapter primers. This protocol allows for shorter primers to amplify attB-PCR products by utilizing four primers instead of the usual two in a PCR reaction. You can find the sequence of these primers in the protocol on page 45 of the "Gateway Technology with Clonase II" manual.

There is a protocol in which all 4 primers mentioned above are in a single PCR reaction. You can find this protocol at in the following article: Quest vol. 1, Issue 2, 2004. https://www.thermofisher.com/us/en/home/references/newsletters-and-journals/quest-archive.reg.in.html. The best ratio of the first gene-specific and the second attB primers was 1:10.

Do you have recommended sequencing primers for pDONR201?

We do not offer pre-made primers, but we can recommend the following sequences that can be ordered as custom primers for sequencing of pDONR201:
Forward primer, proximal to attL1: 5'- TCGCGTTAACGCTAGCATGGATCTC
Reverse primer, proximal to attL2: 5'-GTAACATCAGAGATTTTGAGACAC

Can you please list some references for Gateway Cloning Technology?

1. Yeast two-hybrid protein-protein interaction studies Walhout AJ, Sordella R, Lu X, Hartley JL, Temple GF, Brasch MA, Thierry-Mieg N, Vidal M.

2. Protein Interaction Mapping in C. elegans Using Proteins Involved in Vulval Development. Science Jan 7th 2000; 287(5450), 116-122 Davy, A. et al.

3. A protein-protein interaction map of the Caenorhabditis elegans 26S proteosome. EMBO Reports (2001) 2 (9), p. 821-828. Walhout, A.J.M. and Vidal, M. (2001).

4. High-throughput Yeast Two-Hybrid Assays for Large-Scale Protein Interaction mapping. Methods: A Companion to Methods in Enzymology 24(3), pp.297-306

5. Large Scale Analysis of Protein Complexes Gavin, AC et al. Functional Organization of the Yeast Proteome by Systematic Analysis of Protein Complexes. Nature Jan 10th 2002, 415, p. 141-147.

6. Systematic subcellular localisation of proteins Simpson, J.C., Wellenreuther, R., Poustka, A., Pepperkok, R. and Wiemann, S.

7. Systematic subcellular localization of novel proteins identified by large-scale cDNA sequencing. EMBO Reports (2000) 1(3), pp. 287-292.

8. Protein-over expression and crystallography Evdokimov, A.G., Anderson, D.E., Routzahn, K.M. & Waugh, D.S.

9. Overproduction, purification, crystallization and preliminary X-ray diffraction analysis of YopM, an essential virulence factor extruded by the plague bacterium Yersinia pestis. Acta Crystallography (2000) D56, 1676-1679.

10. Evdokimov, et al. Structure of the N-terminal domain of Yersinia pestis YopH at 2.0 A resolution. Acta Crystallographica D57, 793-799 (2001).

11. Lao, G. et al. Overexpression of Trehalose Synthase and Accumulation of Intracellular Trehalose in 293H and 293FTetR:Hyg Cells. Cryobiology 43(2):106-113 (2001).

12. High-throughput cloning and expression Albertha J. M. Walhout, Gary F. Temple, Michael A. Brasch, James L. Hartley, Monique A. Lorson, Sander Van Den Huevel, and Marc Vidal.

13. Gateway Recombinational Cloning: Application to the Cloning of Large Numbers of Open Reading Frames or ORFeomes. Methods in Enzymology, Vol. 328, 575-592.

14. Wiemann, S. et.al., Toward a Catalog of Human Genes and Proteins: Sequencing and Analysis of 500 Novel Complete Protein Coding Human cDNAs, Genome Research (March 2001) Vol. 11, Issue 3, pp.422-435

15. Reviewed in NATURE: Free Access to cDNA provides impetus to gene function work. 15 march 2001, p. 289. Generating directional cDNA libraries using recombination

16. Osamu Ohara and Gary F. Temple. Directional cDNA library construction assisted by the in vitro recombination reaction. Nucleic Acids Research 2001, Vol. 29, no. 4. RNA interference (RNAi)

17. Varsha Wesley, S. et al. Construct design for efficient, effective and highthroughput gene silencing in plants. The Plant Journal 27(6), 581-590 (2001). Generation of retroviral constructs

18. Loftus S K et al. Generation of RCAS vectors useful for functional genomic analyses. DNA Res 31;8(5):221 (2001).

19. James L. Hartley, Gary F. Temple and Michael A. Brasch. DNA Cloning Using In Vitro Site-Specific Recombination. Genome Research (2000) 10(11), pp. 1788-1795.

20. Reboul et al. Open-reading frame sequence tags (OSTs) support the existence of at least 17,300 genes in C. elegans. Nature Genetics 27(3):332-226 (2001).

21. Kneidinger, B. et al. Identification of two GDP-6-deoxy-D-lyxo-4-hexulose reductase synthesizing GDP-D-rhamnose in Aneurinibacillus thermoaerophilus L420-91T*. JBC 276(8) (2001).

What do attL1 and attL2 sites look like after recombination between attB and attP sites?

The attP1 sequence (pDONR) is:
AATAATGATT TTATTTTGAC TGATAGTGAC CTGTTCGTTG CAACAAATTG ATGAGCAATGCTTTTTTAT AATGCCAACT TTGTACAAAA AAGC[TGAACG AGAAACGTAA AATGATATAA ATATCAATAT ATTAAATTAG ATTTTGCATA AAAAACAGACTA CATAATACTG TAAAACACAA CATATCCAGT CACTATGAAT CAACTACTTA GATGGTATTA GTGACCTGTA]

The region within brackets is where the site is "cut" and replaced by the attB1-fragment sequence to make an attL1 site. The sequence GTACAAA is the overlap sequence present in all att1 sites and is always "cut" right before the first G.

The overlap sequence in attP2 sites is CTTGTAC and cut before C. This is attP2:
ACAGGTCACT AATACCATCT AAGTAGTTGA TTCATAGTGA CTGGATATGT TGTGTTTTAC AGTATTATGT AGTCTGTTTT TTATGCAAAA TCTAATTTAA TATATTGATA TTTATATCAT TTTACGTTTC TCGTTCAGCT TTCTTGTACA AAGTTGGCAT TATAAGAAAG CATTGCTTAT AATTTGTTG CAACGAACAG GTCACTATCA GTCAAAATAA AATCATTATT

So, attL1 (Entry Clone) should be:
A ATAATGATTT TATTTTGACT GATAGTGACC TGTTCGTTGC AACAAATTGA TGAGCAATGC TTTTTTATAA TGCCAACT TT G TAC AAA AAA GC[A GGC T]NN NNN

attL2 (Entry Clone) should be:
NNN N[AC C]CA GCT TT CTTGTACA AAGTTGGCAT TATAAGAAAG CATTGCTTAT CAATTTGTTG CAACGAACAG GTCACTATCA GTCAAAATAA AATCATTATT

The sequence in brackets comes from attB, and N is your gene-specific sequence.

Note: When creating an Entry Clone through the BP reaction and a PCR product, the vector backbone is not the same as Gateway Entry vectors. The backbone in the case of PCR BP cloning is pDONR201.

How large can PCR fragments be and still be cloned into a Gateway Entry vector?

There is no size restriction on the PCR fragments if they are cloned into a pDONR vector. The upper limit for efficient cloning into a TOPO adapted Gateway Entry vector is approximately 5 kb. A Gateway recombination reaction can occur between DNA fragments that are as large as 150 kb.

What is the influence of the attB sequence on protein function, solubility, folding, and expression?

Destination vectors that contain N-terminal fusion partners will express proteins that contain amino acids contributed from the attB1 site, which is 25 bases long. This means that in addition to any tag (6x His and/or antibody epitope tag), the N-terminus of an expressed protein will contain an additional 9 amino acids from the attB1 sequence - the typical amino acid sequence is Thr-Ser-Leu-Tyr-Lys-Lys-Ala-Gly-nnn, where nnn will depend on the codon sequence of the insert.

Effects on protein function: A researcher (Simpson et al. EMBO Reports 11(31):287-292, 2000) demonstrated that GFP fusions (N- terminal and C-terminal) localized to the proper intracellular compartment. The expression constructs were generated using Gateway cloning, so the recombinant protein contained the attB1 or attB2 amino acid sequence. The localization function of the cloned recombinant proteins was preserved.

Effects on expression: We have seen no effect of the attB sites on expression levels in E. coli, insect and mammalian cells. The gus gene was cloned into bacterial expression vectors (for native and N-terminal fusion protein expression) using standard cloning techniques and expressed in bacteria. Gus was also cloned into Gateway Destination vectors (for native and N-terminal fusion expression) and expressed. When protein expression is compared, there was no difference in the amount of protein produced. This demonstrates that for this particular case, the attB sites do not interfere with transcription or translation.

Effects on solubility: A researcher at the NCI has shown that Maltose Binding Protein fusions constructed with Gateway Cloning were soluble. The fusion proteins expressed had the attB amino acid sequence between the Maltose Binding Protein and the cloned protein. It is possible that some proteins containing the attB sequence could remain insoluble when expressed in E.coli.

Effects on folding: Two Hybrids screens show the same interacters identified with and without the attB sequence. Presumably correct protein folding would be required for protein-protein interactions to take place. It is possible that some proteins containing the attB sequence may not fold correctly.

Must PCR conditions be changed once the original PCR primers have attB sequence added to them?

Since the attB sequences are on the 5' end of oligos, they will not anneal to the target template in the first round of PCR. Sometimes the PCR product is more specific with the attB primers, probably due to the longer annealing sequence (all of attB plus gene specific sequence) after the first round of amplification. Generally there is no need to change PCR reaction conditions when primers have the additional attB sequence

Can PCR primers be tailed directly with attL sites for direct recombination into the destination vector?

No, this is not really feasible due to the fact that the attL sequence is approximately 100 bp, which is too long for efficient oligo synthesis. Our own maximum sequence length for ordering custom primers is 100 nucleotides. In contrast, the attB sequences are only 25 bp long, which is a very reasonable length for adding onto the 5' end of gene-specific PCR primers.

Where can I get Gateway vector sequences and maps?

Vector information can be found in the product manuals or directly on our web site by entering the catalog number of the product in the search box. The vector map, cloning site diagram, and sequence information will be linked to the product page.

From where does Gateway get its lambda nomenclature, and is it consistent with textbook nomenclature for lambda recombination?

The Gateway nomenclature is consistent with lambda nomenclature, but we use numbers to differentiate between modified versions of the att sites (attB1, attB2, attP1, attP2, and so on). We have introduced mutations in the att sites to provide specificity and directionality to the recombination reaction. For example, attB1 will only recombine with attP1 and not with attP2.

What is the first step in an experiment with the Gateway system?

The first step is to create an Entry clone for your gene of interest. We have 3 options to do this: The first is by BP recombination reaction using the PCR Cloning System with Gateway Technology. This is recommended for cloning large (>5 kb) PCR products. We also have Gateway compatible TOPO Cloning vectors such as pCR8/GW/TOPO and pENTR/D-TOPO. The final option is to use restriction enzymes to clone into a pENTR Dual Selection vector.

What are the prerequisites for Gateway cloning and expression?

The gene of interest must be flanked by the appropriate att sites, either attL (100 bp) in an Entry clone or attB (25 bp) in a PCR product. For Entry clones, everything between the attL sites will be shuttled into the Gateway destination vector containing attR sites, and a PCR product flanked by attB sites must be shuttled into an attP-containing donor vector such as pDONR221.

The location of translation initiation sites, stop codons, or fusion tags for expression must be considered in your initial cloning design. For example, if your destination vector contains an N-terminal tag but does not have a C-terminal tag, the vector should already contain the appropriate translation start site but the stop codon should be included in your insert.

Will increasing the Gateway cloning reaction time improve recombination efficiency?

Yes, increasing the incubation time from 1 hour to 4 hours will generally increase colony numbers 2-3 fold. An overnight incubation at room temperature will typically increase colony yield by 5-10 fold.

How many times can I thaw BP Clonase II and LR Clonase II?

BP Clonase II and LR Clonase II can be freeze/thawed at least 10 times without significant loss of activity. However, you may still want to aliquot the enzymes to keep freeze/thaw variability to a minimum.

These enzymes are more stable than the original BP and LR Clonase and can be stored at -20 degrees C for 6 months.

How clean must my DNA be to use in a Gateway cloning reaction?

Mini-prep (alkaline lysis) DNA preparations work well in Gateway cloning reactions. It is important that the procedure remove contaminating RNA for accurate quantification. Plasmid DNA purified with our S.N.A.P. nucleic acid purification kits, ChargeSwitch kits, or PureLink kits are recommended.

How would you incorporate a leader sequence for secretion into an entry vector?

A simple way to express a protein with a leader sequence is to have the leader sequence encoded in the destination vector. The other option is to have the leader sequence subcloned into the entry vector using restriction enzymes, or incorporate the leader sequence into the forward PCR primer when cloning a PCR product into the entry vector. Please see Esposito et al. (2005), Prot. Exp. & Purif. 40, 424-428 for an example of how a partial leader sequence for secretion was incorporated into an entry vector.

Where is the ATG relative to the 5' attB site in a Gateway expression clone?

This depends on whether you are expressing a fusion or a native protein in the Gateway destination vector. For an N-terminal fusion protein the ATG will be given by the destination vector and it will be upstream of the attB1 site. For a C-terminal fusion protein or a native protein, the ATG should be provided by your gene of interest, and it will be downstream of the attB1 site.

Are the Gateway attB1 and attB2 sites the same as the attB site used for recombination into E. coli by bacteriophage lambda?

The Gateway attB sites are derived from the bacteriophage lambda site-specific recombination, but are modified to remove stop codons and reduce secondary structure. The core regions have also been modified for specificity (i.e., attB1 will recombine with attP1 but not with attP2).

Will Gateway att sites affect the expression of my protein?

Expression experiments have shown that the extra amino acids contributed by the attB site to a fusion protein will most likely have no effect on protein expression levels or stability. In addition, they do not appear to have any effect on two-hybrid interactions in yeast. However, as is true with the addition of any extra sequences that result from tags, the possible effects will be protein-dependent.

Can the attB primers anneal in a non-specific manner?

No, attB primers are highly specific under standard PCR conditions. We have amplified from RNA (RT-PCR), cDNA libraries, genomic DNA, and plasmid templates without any specificity problems.

What is the smallest fragment that can be used in a Gateway reaction?

The smallest size we have recombined is a 70 bp piece of DNA located between the att sites. Very small pieces are difficult to clone since they negatively influence the topology of the recombination reaction.

Are there any limitations on the insert length in Gateway cloning?

There is no theoretical size limitation. PCR products between 100 bp and 11 Kb have been readily cloned into a pDONR Gateway vector. Other DNA pieces as large as 150 kb with att sites will successfully recombine with a Gateway-compatible vector. Overnight incubation is recommended for large inserts.

What primer purity should be used for adding attB sites to my PCR product?

Standard desalted purity is generally sufficient for creating attB primers. We examined HPLC-purified oligos for Gateway cloning (about 50 bp long) and found only about a 2-fold increase in colony number over standard desalted primers. If too few colonies are obtained, you may try to increase the amount of PCR product used and/or incubate the BP reaction overnight.

I'm getting no fluorescence signal with my expression clone containing EmGFP. What should I do?

Please ensure that the recommended filter sets for detection of fluorescence are used. Use an inverted fluorescence microscope for analysis. If desired, allow the protein expression to continue for 1-3 days before assaying for fluorescence.

I'm seeing nonspecific, off-target gene knockdown. What should I do?

The target sequence used may contain strong homology to other genes; please select a different target region.

I am not getting any colonies after titering. What would suggest I try?

Perform a kill curve to determine the antibiotic sensitivity of your cell line. Ensure that viral stocks are stored properly at -80 degrees C, and do not undergo freeze/thaw more than 3 times. Lastly, transducer the lentiviral contruct into cells in the presence of Polybrene reagent.

I'm getting few or no colonies, even with the transformation control. What could be the cause of this?

Ensure that the competent cells used were stored properly at -80 degrees C, and thawed on ice for immediate use. When adding DNA, mix competent cells gently: do not mix by pipetting up and down. Also do not exceed the maximum recommended amount of DNA for transformation (100 ng) or allow the volume of DNA added to exceed 10% of the volume of the competent cells, as these may inhibit the transformation.

I'm seeing a low level of gene knockdown or no gene knockdown. What can you suggest I try?

Low expression levels can be due to several factors. Please see the suggestions below:

- Low transfection efficiency: ensure that antibiotics are not added to the media during transfection, and that cells are at the proper cell confluency; optimize transfection conditions by varying the amount of transfection reagent used.
- Try a time course assay to determine the point at which the highest degree of gene knockdown occurs.
- Mutations are present in your construct: analyze the transformants by sequencing the ds oligo insert to verify its sequence.
- Target region is not optimal: select a different target region.
- Ensure siRNA is designed according to guidelines listed in the respective manual.

I'm seeing cytotoxic effects after transfection of my shRNA/miRNA construct. What is causing this?

You can try to scale back the amount of transfection reagent used, or use a different reagent for the transfection. Additionally, ensure that the plasmid used is pure and properly prepared for transfection.

I'm trying to create my entry clone but am seeing mutated inserts. What should I do?

We highly recommend sequencing positive transformants to confirm the sequence of the ds oligo insert. When screening transformants, we find that up to 20% of the clones may contain mutated inserts (generally 1 or 2 bp deletions within the ds oligo). The reason for this is not known, but may be due to triggering of repair mechanisms within E. coli as a result of the inverted repeat sequence within the ds oligo insert. Note: Entry clones containing mutated ds oligo inserts generally elicit a poor RNAi response in mammalian cells. Identify entry clones with the correct ds oligo sequence and use these clones for your RNAi analysis.
Mutated inserts could also be caused by using poor-quality single-stranded oligos. Use mass spectrometry to check for peaks of the wrong mass, or order HPLC- or PAGE-purified oligos to avoid this problem.

I'm trying to anneal my oligos to create a ds oligo for ligation into one of your shRNA or miRNA RNAi vectors. When I run my ligated ds oligo on an agarose gel, I do not see any bands representing the ds oligo. What could be happening?

- Verify that the sequence of the bottom-strand oligo is complementary to the sequence of the top-strand oligo.
- For the shRNA vectors, make sure that you mix single-stranded oligos with complementary sequences. The top-strand oligo should include CACC on the 5' end, while the bottom-strand oligo should include AAAA on the 5' end.
- For the miRNA vectors, make sure that the top-strand oligo includes TGCT at the 5' end and that the bottom-strand oligo includes CCTG at the 5' end.

I'm trying to anneal my oligos to create a ds oligo for ligation into one of your shRNA or miRNA RNAi vectors. When I run my ligated ds oligo on an agarose gel, the bands are weak. What could be happening?

Please review the possibilities below:

- Single-stranded oligos designed incorrectly; verify that the sequence of the bottom-strand oligo is complementary to the sequence of the top strand oligo.
- Ensure that oligos are annealed at room temp for 5-10 minutes after heating to 95 degrees C.
- Check the molar ratio you are using for annealing top and bottom-strand oligo; equal amounts should be used.

I am using the pcDNA6.2-GW/EmGFP-miR expression construct, but need to remove the EmGFP. How can I do this?

Perform a DraI digestion and self ligation of the vector to form a pcDNA6.2-GW/miR clone expressing the same pre-miRNA. See page 40 of the manual for a more detailed protocol.

Can I create a stable cell line expressing my miRNA?

The pcDNA6.2-GW/+EmGFP-miR expression construct contains the Basticidin resistance gene to allow for Blasticidin selection of mammalian cells that are stably trnasfected with the pcDNA6.2-GW/+EmGFP-miR construct. Start by performing a kill curve on your untransfected mammalian cells, followed by transfection of your expression clone into the mammalian cell line of choice and selecting for stable cell lines using Blasticidin.

I would like to create a scrambled and/or point mutation negative control for my miR RNAi experiments. How should I do this?

In order to create a scramble miR RNAi negative control we recommend keeping 2-3 nt on each end of the guide RNA the same and scrambling the middle, then conducting BLAST to look for obvious problems. In order to create a point mutation miR RNA negative control, a single change may not be enough, but the best place to put it would be at nt 10 or 11 of the antisense sequence.

How do I order miR RNAi?

Please visit our BLOCK-iT RNAi Designer and select miR RNAi as your target design option. This miR RNAi can then be cloned into the pcDNA6.2-GW/miR and pcDNA6.2/EmGFP-miR vectors.

I noticed there is a requirement for a 5' G after the overhang sequence when designing the pre-miRNA sequence for BLOCK-iT Pol II vectors. Is this G absolutely necessary?

We would expect this G to be critical, as it is part of the last base pair in the “flanking” region (derived from mouse miR-155) before the start of the mature miRNA. The mature miRNA sequence will act as the guide strand for the RNAi.


For Research Use Only. Not for use in diagnostic procedures.

Product Title
Select an issue

By clicking Submit, you acknowledge that you may be contacted by Fisher Scientific in regards to the feedback you have provided in this form. We will not share your information for any other purposes. All contact information provided shall also be maintained in accordance with our Privacy Policy.